042409121708 moroccan j biol 07 2008 4-5.pdf

Moroccan Journal of Biology 07-2008/N 4-5 Isolation and characterisation of yeast strains for the olive fly
Bactrocera oleae biological control
Ahmed El Haidani1, Malika Chakri1, Mohammed Mostakim1, Mohammed El Mzibri2, Jalila. Boudouma1, Mhammed El Hassouni3, Abdelatif Haggoud1, Mohamed Housaini Iraqui1 Abdellah Houari1 and Saad Koraichi Ibnsouda1*, 1Laboratoire de Biotechnologie Microbienne, Université Sidi Mohammed Ben Abdellah, Faculté des
Sciences et Techniques de Fès, Route d’Immouzer, BP 2202, Fès, MAROC. Corresponding author: 2Unité de Biologie et Recherche Médicale, Centre National de l'Energie, des Sciences et Techniques
Nucléaires (CNESTEN), BP 1382 RP. 10001 Rabat, MAROC. 3Laboratoire de Biotechnologie, Université Sidi Mohammed Ben Abdellah, Faculté des Sciences Dhar El
Abstract
Bactrocera oleae (Diptera: Tephritidae) is one of the major pests of the olive fruits all
around the Mediterranean basin. Our laboratory is interested in developing microbial
strategies to fight this insect. During B. oleae’s breeding, certain pupas were unnable to
accomplish their development cycle. These pupas were used to isolate pathogenic yeast
strains against B. oleae. Two strains were shown to be particularly interesting. Their
actions during different stages of B. oleae’s development were determined. The two
strains were identified as Pichia guilliermondii and Debaryomyces hansenii according
to both conventional and molecular methodologies.
Key words: Bactrocera oleae (Diptera: Tephritidae), Bio-control, Debaryomyces hansenii, Pichia guilliermondii,
Yeast strains.
Introduction
The olive fruit’s fly Bactrocera oleae usually spread by aircraft over vast areas, (Diptera: Tephritidae) is one of the major Mediterranean basin. In fact, the damages caused by this insect are very important become black and fall before maturation; insecticide residues in the olive oil mainly and the quality of oil is degraded (high caused by high concentrations of lipophilic degree of acidity, low organoleptic quality and unpleasant flavour). This leads to the decrease of the commercial values of the improve B. oleae control including the male olives and their oil. Furthermore, it is sterilization technique (Tzanakakis, 1967) important to note that the international and the use of pheromone baits (Haniotakis regulations tolerate less than 2 % of B. et al. 1987, Broumas et al. 1990). Natural The control of B. oleae population is method of control is based on the use of killing activity have been developed in bio- conventional pesticides. In fact, control of phytopathogenic micro-applications of some organophosphate organisms and pathogens in agriculture and mainly used to kill B. oleae adults. A. El Haidani et al. / Moroccan J. Biol. 4-5 (2008) 1-8 Janisiewcz & Korsten 2002). There exists a currently used for insect control (Lacey et limited number of pathogenic yeast species and they generally belong to Candida, reported to suffer high infection levels Saccharomyces and caused by fungi. Entomophthora muscae Malassezia genera. These yeasts are known infects several species (Delia antigua, Delia as "opportunists" i.e. that they are frequent coarctata, Chamaepsila rosae) and flies in the environment but do not parasitize any associated with animal production (Musca host unless the latter presents intrinsic or penetration, adhesion and multiplication in vivo (Drouhet & Dupont, 1979). The yeast killer toxins (mycocines) are suspected to virulence of some fungi against B. oleae play a significant ecological role like a form adults, in particular Beauveria bassiana, Beauveria brongniartii and other species isolated from B. oleae pupae and Sesamia occasional high infection levels in insect demonstrated that the B. oleae fly is populations despite the fact that during the sensitive to different tested isolates of toxic last years, several species have been and still are used and engineered as biocontrol Sesamia nonagrioides was the most virulent agents (Tanada & Kaya 1993, Hajek & St. to B. oleae. Its high toxicity was related to Leger 1994). Strains such as Beauveria bassiana (Balsamo) Vuillemin, Metarhizium anisopliae (Metschnikoff), isolate pathogenic yeast strains from dead Verticillium lecanii (Zimmermen) and pupas and evaluate their toxicities against Paecilomyces fumosoroseus (Wize) are B. oleae adults in order to use them in different bio-control strategies.
Materials and methods
Yeast culture medium
then washed three times in sterile distilled water (Cavados et al., 2001). The treated Rij (1987) was used for yeast’s isolation volume of 100 µl of various dilutions (10-1 medium containing three antibiotics (see µg/ml) and Tetracyclin (30 µg/ml) to avoid preserved at 4°C for frequent use and at - Yeast isolated from dead pupas
Identification of yeast strains
during the breeding of B. oleae in our amplification of the ribosomal RNA 5.8 S organisms contaminating the surfaces, the 3') primers allow the amplification of 5.8 S A. El Haidani et al. / Moroccan J. Biol. 4-5 (2008) 1-8 program, version 5, May 2000” (Barnett et amplification reaction was performed in a al., 2000). Briefly, the physiological tests final volume of 50 µl containing 50 pmol of each primer (ITS-1 and ITS-4), 200 µM polymerase buffer. The mixture was first temperature tolerance tests, cyclohexemide denatured at 94°C for 7 min. Then, thirty- vegetative reproduction and formation of extension at 72°C for 90 s. At the end of the last cycle, the mixture was incubated at 72°C for 7 min. For each reaction, a negative control missing DNA template, Test of yeast strains pathogenesis on B.
oleae development
Efficient amplification was confirmed by gel electrophoresis on 1.5% agarose gel. yeast strain tested was spread over an YPG medium and incubated at 30°C for 48 h. A carpet of each strain was obtained in each dish. B. oleae L3 larvae recovered from reactions, then the sequence reaction for medium (Tsitsipis, 1977) during 24 hours thermocycler. The sequencing reaction was containing the tested strain and incubated containing 20 pmol of each primer (ITS-1 at 25°C. The development of these larvas or IST-4), 3 µl of Big Dye (version 1.1) was followed until their transformation to and 2 µl of purified PCR product. Twenty five cycles were performed: denaturation at 96°C for 10 s, primer annealing at 55°C for 10 s, and extension at 60°C for 4 min. In B. oleae adults used in this work were order to eliminate the excess of labelled obtained from our laboratory at 24 °C with Control Strain
study was isolated in our laboratory from larvae of B. oleae. This strain identified as (ABI Prism 310 Genetic Analyser, Applied Candida diddensiae (Chakri et al., 2007) Biosystem) and data analysis was done by was used as control so as to estimate the rate of pathogenic capacity of the tested Nucleotide sequences
the molecular procedure, the conventional Barnett et al. 2000). The results analysis was done with the “Yeast identification PC A. El Haidani et al. / Moroccan J. Biol. 4-5 (2008) 1-8 Table 1. Sequenced product and registered number in GenBank.
Sequenced product
registered number in
Yeast Strain
Results
Isolation of yeast strains
Identification of yeast strains
During B. oleae breeding, some dead used to isolate yeast strains that would be Several strains were isolated on YPG agar containing three antibiotics (Ampicilline, sequences are reported in figure 1. These tetracycline and kanamycine). Eight strains program (Table 3). For strain YS1, the 581 nucleotides sequenced show 98% of Test of yeast strains pathogenesis on B.
oleae development
correspond to two species Candida B. oleae were followed up on a medium psychrophila and Debaryomyces hansenii.
Furthermore, the 540 nucleotides sequence pupae and the percentage of lethality were recorded. Among the eight tested strains, Pichia guilliermondii (Table 3 and important rate of lethality against B. oleae.
The results obtained for these strains are were subject to conventional identification strong lethality of B. oleae. This mortality according to Barnett et al. (2000). This larval stage (85.2%), whereas the mortality between Debaryomyces hansenii and at the pupa stage was only 10.1%. In the Candida psychrophila. Thus, strains YS1 presence of SY1 strain, the larval viability and YS2 were identified as Debaryomyces hansenii and Pichia guilliermondii with a Table 2. Test of yeast strains pathogenesis on B. oleae development (Page 9; lane 15).
Larval development and pupation of B. oleae were followed up on a medium containing the tested yeast
strain. In parallel, the number of dead larvae and pupae and the percentage of lethality were montred. SY2
showed a strong lethality of B. Oleae ( 95 %) and acted mainly at the larval stage (85.2%), whereas the
mortality at the pupa stage was only 10.1%. For SY1 strain, the larval viability was very weak (19.4).
Strain Total
Dead pupae
total lethality
Emerged adults
(larvae and pupas)
(viability)
Candida
diddensiae
(control)
A. El Haidani et al. / Moroccan J. Biol. 4-5 (2008) 1-8 Table 3. Sequence analysis of RNA 5,8S PCR products amplified from YS1 and YS2 yeast strains
(Page 10, lane 1 and 6).
The sequences of YS1 and YS2 strains are reported. These sequences were compared with available DNA
sequence database using BLAST program. For strain YS1, the 581 nucleotides sequenced show 98% of
homology with the ITS DNA sequences found in the GeneBank database that correspond to two species
Candida psychrophila and Debaryomyces hansenii. The 540 nucleotides sequence of strain YS2 show
98% of homology with the ITS DNA sequences found in the GeneBank database that correspond to
Pichia guilliermondii.
Sequenced
Percentage of
Reference
homology
1 TTGTTTGTTATATTGTAAGGCCGAGCCTAGAATACCGAGAAATATACCATTAAACTATTC 60 61 AACGAGTTGGATAAACCTAATACATTGAGAAGTGCATATAGCACTATCCAGTACCACTCA 120 121 TGCGCAATACATTTCAAGCAAACGCCTAGTTCGACTAAGAGTATCACTCAATACCAAACC 180 181 CGAAGGTTTGAGAGAGAAATGACGCTCAAACAGGCATGCCCTTTGGAATACCAAAGGGCG 240 241 CAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCATATTACTTATCGCA 300 301 TTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGA 360 361 TTTTTTGAATTTAATCAACAAATTGACAATTAAAATAAATAACAATTCAATATAAATATT 420 421 GAAGTTTAGTTTAGTAAACCTCTGGCCCAAACTATTTCTAGTCCAGACCAAAGCAAGAGT 480 481 TCTTGTAATAACAAAAAACACTGTGTGTAAGGGTTTTTCGCCGCGCAATTAAGCGCTGGC 540 541 AAAAAGAATACTGGAATGATCCTTCCGCAGGTTCCCCTACG 581 Figure 1a.
1 TTGTTTGGTTGTTGTAAGGCCGGGCCAACAATACCAGAAGATATCCCGCCACACCATCTC 60 61 AACGAGTGTGGATAAACCTAATACATCTGAGAGGTCGACAGCACTATCCAGTACTACCCA 120 121 TGCGCAATACTCTCTTCAAGCAAACGCCTAGTCCGACTAAGAGTATCACTCAATACCAAA 180 181 CCCGGGGGTTTGAGAGAGAAATGACGCTCAAACAGGCATGCCCTCTGGAATACCAGAGGG 240 241 CGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCATATTACTTATCG 300 301 CATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAA 360 361 GATTAATTCAAAATTTGACTAACTGTAAAAATAATTAAATTGTGTTTTGTTAAACCTCTG 420 421 GCCCAACCTATCTCTAGGCCAAACCAAAGCAAGAGTTCTGTATCAAAAAGACACTGTGTG 480 481 TAAGGTTTTTCGCCGCGCAGTTAAGCGCTGGCAAAAGAATACTGTAATGATCCTTCCGCA 540 Figure1b.
Figure 1 (Page 9, lane 12 and 18). Nucleotide sequence of the ITS amplified fragments of the two
isolated yeast strains.
The two PCR products from the yeast strains YS1 and YS2 were sequenced on both strands.
Figure 1a: Sequence of the 5.8S ITS region of strain YS1
Figure 1b: Sequence of the 5.8S ITS region of strain YS2
Discussion
investigations were made to evaluate the strategies such as biocontrol can provide additional management tools as biocontrol of B. oleae fly. Konstantopoulou supplements to other control measures for & Mazmenos (2005) showed that several yeast strains, especially M. hiemalis, have a toxic effect against B. oleae adults. Two yeast strains were isolated from death B. from the market or fail due to new strains oleae pupas. Conventional and molecular identifications of these strains showed that they belong to Pichia guilliermondii and in isolating pathogenic yeast strains from Debaryomyces hansenii, respectively. The dead B. oleae pupas. Indeed, several virulence of Pichia guilliermondii strain A. El Haidani et al. / Moroccan J. Biol. 4-5 (2008) 1-8 was the highest - 95.3 % of lethality - when compared to that of D. hansenii strain with frequent yeast species to be associated with 53 % lethality only. On the other hand, P. guilliermondii strain seems to act mainly at non-pathogenic. It has been reported that the larval stage since only few larvae had D. hansenii grew mainly on the cheese contrast, D. hansenii seems to act satisfied (Leclercq-Perlat et al., 1999; preferentially at the pupal stage (33.6 % of Bonaïti et al., 2004). The single case of infection associated to D. hansenii was reported with bone infection (Yamamoto et reports up to date on the susceptibility of B. oleae fly to P. guilliermondii and D. hansenii yeast strains. However, Pichia products is increasing, they only represent guilliermondii was reported in several about 1% of agricultural chemical sales. works to be used for bio-control essays. Yeast based biocontrol strategies offer an Wisniewski et al. (1991) have isolated a P. guilliermondii strain that protects apples from postharvest fruit rotting fungi Botrytis demonstrated, for the first time, that P. cinerea and Penicillium expansum. Other guilliermondii and D. hansenii have studies have demonstrated the ability of P. guilliermondii to inhibit the growth of specifically, the olive fruit’s fly B. Oleae.
The results obtained in this paper are of application of these strains for bio control Aspergillus flavus (Paster et al., 1993). against the devastating insect B. oleae.
Arras et al. (1998) reported the use of a Generally, the toxicity of yeast species strain of P. guillermondii in bio-control of resides in their produced metabolites. The blue mould of citrus fruits. The abilities of high toxicity of P. guilliermondii and D. Pichia anomala, Pichia guilliermondii, and hansenii may be due to some metabolites Saccharomyces cerevisiae to inhibit the produced by the two species. This makes it growth of the mould Penicillium roqueforti necessary for further research to identify and eventually isolate these potent active 1995). Furthermore, yeast’s application as biocontrol agents to prevent mold decay of fruits and vegetables has been described biorational screening processes to identify Richards et al. (2004) have shown that microorganisms with biocontrol potential. Debaryomyces hansenii and Pichia guilliermondii were antagonists to Salmonella Poona in cantaloupe juice. production conditions, increased emphasis on combining biocontrol strains with each guilliermondii and insects has already been other and with other control methods and documented. Different strains in the Pichia guilliermondii clade were isolated from the system will be of great interest for the control of the olive fruit fly B. oleae and (Frants & Mertvetsova 1986, Suh & Blackwell 2004). A. El Haidani et al. / Moroccan J. Biol. 4-5 (2008) 1-8 Acknowledgments
Barji Abdelhak for their critical reading of References
Arambourg Y (1986) Traité d’entomologie industrial origin. Bioresource technology oléicole. Conseil Oléicole International, 71: 41- 44.
Arras DE, Cicco V, Arru S, Lima G (1998) (2001) Identification of entomopathogenic citrus fruits and the mode of action of an Bacillus isolated from Smulium –Diptera, isolate of Pichia guilliermondii. Journal of Smuliidae) Larvae and Adults. Mem Inst horticultural science and biotechnology 73:
Oswaldo Cruz, Rio de Janeiro 96(7): 1017-
Yeasts; Characteristics and identification. 3rd ed., Cambridge University Press, UK. Ibnsouda KS (2007) Yeast strains from the endogenous microfloras of the olive flies Bactrocera oleae larvae which could physiological basis of killer character in yeast. Proc.11th. Int. Cong., Gent, 11: 202-
polyphenols. Annals of Microbiology 57(2): 143-148
Bonaïti C, Leclercq-Perlat MN, Latrille E, Delrio G (1992) Integrated control in olive Debaryomyces hansenii of Smear Soft Environmentally Safer Agriculture, Proc. Science Association. J. Dairy Sci. 87:
3976-3988.
Drik R (2000) Specific PCR primers to identify arbuscular mycorrhizal fungi within colonized roots. Mycorrhiza 10: 73-
Stavrakis G (1990) Comparative study of a mass trapping method and various bait sprays for the control of the olive fruit fly- iatrogènes à localisation profonde dues à Alternative, Cassida JE, Elsevier Science opportunists. Dermatologica Suppl(1): 94-
112.
Buzzini P, Martini A (2001) Finger printing yeast cultures of industrial interest by the yeast killer system. Ag. Biotech. associations with mosquitoes of the genus Agro-Food. Industry Hitech. 20-22.
Aedes Mg. (Diptera, Culicidae) in the Tom-Ob river region. Nauchnye Doki Vyss Buzzini P, Martini A (2000) Biodiversity Shkoly Biol Nauki 4: 94-8.
of killer activity in yeasts isolated from the
Brazilian rain forest. Can. J. Microbial 46:
Review of Phytopathology 43: 337-359.
Buzzini P, Martini A (1999) Production of carotenoids by strains of Rhodotorula glutinis cultered in raw materials of agro- toxins), in the yeasts, a taxonomic study. Kurtzman CP & Fell J W, Elseiver. A. El Haidani et al. / Moroccan J. Biol. 4-5 (2008) 1-8 Hajek AE, St. Leger RJ (1994) Interactions Saccharomyces cerevisiae. Appl. Environ. Microbiol 61(3): 1027-32.
hosts. Annu. Rev. Entomol. 39: 293–322
(2004) Survey of yeasts for antagonistic (1987) Area-wide management of the olive fruit fly by feeding attractants and sex pheromones on toxic traps. Procedings of 67(10): 2132-42.
‘Fruit flies’, Crete, Greece, 549-560. beetle-associated yeast species in the Pichia Biological control of postharvest dieases of guilliermondii clade, 5(1): 87-95.
fruits. Ann. Rev. Phytopathol. 40.
Evaluation of Beauveria bassiana and B. brongniartii and four wild- type fungal species of B. olea and Ceratitis capitata.
for the mass rearing of the olive fruit fly, Biocontrol 50: 293-305.
Dacus oleae (Gmel) (Diptera tephritidae). Z. Angew. Entomol 83: 419-426.
Tzanakakis ME (1967) Control of the olive fruit fly, Dacus oleae Gmel., with radiation or chemical sterilization procedures. Final control agents: do they have a future? Biol. Control 21: 230-248.
Leclercq-Perlat MN, Oumer A, Bergere JL, (1991) Mode of action of the postharvest Debaryomyces hansenii on a bacterial biocontrol yeast, Pichia guilliermondii . I. surface-ripened soft cheese. Journal of Characterization of attachment to Botrytis cinerea. Physiol. Mol. Plant Pathol. 39:
Evaluation of the potential of the yeast Pichia guilliermondii as a biocontrol agent stored soya beans. Mycological Research Debaryomyces Hansenii. Eur. Respir. J. 97(10): 1201-1206.
20: 1351-1353.
Petersson S, Schnurer J (1995) Biocontrol Young TW (1987) Killer yeasts. In Yeasts. stored under airtight conditions by Pichia

Source: http://www.fst.ac.ma/mjb/vol1/Iss4-5/ARTs/Isolation%20and%20characterisation%20of%20yeast%20strains%20for%20the%20olive%20fly.pdf